Product Details

SNP ID

rs217625

Assay Type

Validated

NCBI dbSNP Submissions

NA

Location

Chr.6:83553478 on Build GRCh38

Set Membership

HapMap Validated

Context Sequence [VIC/FAM]

AGAATCACTTGAATAGCACCTCTCT[A/G]ACCGCATTTTCATGAACATGACACA

Phenotype

MIM: 607923

Polymorphism

A/G, Transition Substitution

Allele Nomenclature

Literature Links

SNAP91 PubMed Links

Additional Information

For this assay, SNP(s) [rs79445663] are located under a primer sequence. To help evaluate the possible impact of a given SNP on your experiment, please refer to the 1000 Genomes and NCBI dbSNP databases. A higher minor allele frequency in your study population represents a higher risk to assay performance.

Gene Details

Gene

SNAP91

Gene Name

synaptosome associated protein 91

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001242792.1	3579	UTR 3			NP_001229721.1
NM_001242793.1	3579	UTR 3			NP_001229722.1
NM_001242794.1	3579	UTR 3			NP_001229723.1
NM_001256717.1	3579	UTR 3			NP_001243646.1
NM_001256718.1	3579	UTR 3			NP_001243647.1
NM_014841.2	3579	UTR 3			NP_055656.1
XM_005248770.4	3579	UTR 3			XP_005248827.1
XM_006715615.1	3579	UTR 3			XP_006715678.1
XM_011536265.1	3579	UTR 3			XP_011534567.1
XM_011536266.1	3579	UTR 3			XP_011534568.1
XM_011536269.1	3579	UTR 3			XP_011534571.1
XM_011536271.1	3579	UTR 3			XP_011534573.1
XM_011536273.2	3579	UTR 3			XP_011534575.1
XM_011536275.2	3579	UTR 3			XP_011534577.1
XM_011536276.2	3579	UTR 3			XP_011534578.1
XM_011536277.1	3579	UTR 3			XP_011534579.1
XM_017011554.1	3579	UTR 3			XP_016867043.1
XM_017011555.1	3579	UTR 3			XP_016867044.1
XM_017011556.1	3579	UTR 3			XP_016867045.1
XM_017011557.1	3579	UTR 3			XP_016867046.1
XM_017011558.1	3579	UTR 3			XP_016867047.1
XM_017011559.1	3579	UTR 3			XP_016867048.1
XM_017011560.1	3579	UTR 3			XP_016867049.1
XM_017011561.1	3579	UTR 3			XP_016867050.1
XM_017011562.1	3579	UTR 3			XP_016867051.1
XM_017011563.1	3579	UTR 3			XP_016867052.1
XM_017011564.1	3579	UTR 3			XP_016867053.1
XM_017011565.1	3579	UTR 3			XP_016867054.1
XM_017011566.1	3579	UTR 3			XP_016867055.1
XM_017011567.1	3579	UTR 3			XP_016867056.1
XM_017011568.1	3579	UTR 3			XP_016867057.1
XM_017011569.1	3579	UTR 3			XP_016867058.1
XM_017011570.1	3579	UTR 3			XP_016867059.1
XM_017011571.1	3579	UTR 3			XP_016867060.1
XM_017011572.1	3579	UTR 3			XP_016867061.1
XM_017011573.1	3579	UTR 3			XP_016867062.1
XM_017011574.1	3579	UTR 3			XP_016867063.1
XM_017011575.1	3579	UTR 3			XP_016867064.1
XM_017011576.1	3579	UTR 3			XP_016867065.1
XM_017011577.1	3579	UTR 3			XP_016867066.1
XM_017011578.1	3579	UTR 3			XP_016867067.1
XM_017011579.1	3579	UTR 3			XP_016867068.1
XM_017011580.1	3579	UTR 3			XP_016867069.1
XM_017011581.1	3579	UTR 3			XP_016867070.1
XM_017011582.1	3579	UTR 3			XP_016867071.1
XM_017011583.1	3579	UTR 3			XP_016867072.1
XM_017011584.1	3579	UTR 3			XP_016867073.1
XM_017011585.1	3579	UTR 3			XP_016867074.1
XM_017011586.1	3579	UTR 3			XP_016867075.1
XM_017011587.1	3579	UTR 3			XP_016867076.1
XM_017011588.1	3579	UTR 3			XP_016867077.1
XM_017011589.1	3579	UTR 3			XP_016867078.1
XM_017011590.1	3579	UTR 3			XP_016867079.1

View Full Product Details