Product Details

SNP ID: rs324015
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.12:57096317 on Build GRCh38
Set Membership: HapMap
Context Sequence [VIC/FAM]: CGCTGCAGGTGCAGGCATGTTGGGG[C/T]GTGTCTCAGAGCCTGAACTTCCCTT
Phenotype: MIM: 602381 MIM: 616496 MIM: 601512
Polymorphism: C/T, Transition substitution
Allele Nomenclature
Literature Links: NAB2 PubMed Links

Gene Details

Gene: NAB2
Gene Name: NGFI-A binding protein 2

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_005967.3	3179	Intron			NP_005958.1
XM_005268894.2	3179	Intron			XP_005268951.1

Gene: NEMP1
Gene Name: nuclear envelope integral membrane protein 1

There are no transcripts associated with this gene.

Gene: STAT6
Gene Name: signal transducer and activator of transcription 6

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001178078.1	3179	UTR 3			NP_001171549.1
NM_001178079.1	3179	UTR 3			NP_001171550.1
NM_001178080.1	3179	UTR 3			NP_001171551.1
NM_001178081.1	3179	UTR 3			NP_001171552.1
NM_003153.4	3179	UTR 3			NP_003144.3
XM_006719575.2	3179	UTR 3			XP_006719638.1
XM_011538703.2	3179	UTR 3			XP_011537005.1
XM_011538704.2	3179	UTR 3			XP_011537006.1
XM_011538705.2	3179	UTR 3			XP_011537007.1
XM_011538706.2	3179	UTR 3			XP_011537008.1
XM_011538707.2	3179	UTR 3			XP_011537009.1
XM_011538708.2	3179	UTR 3			XP_011537010.1
XM_011538709.2	3179	UTR 3			XP_011537011.1

View Full Product Details