Product Details

SNP ID: rs541806
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.3:38456008 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: GACAGGACAGCTTGAGACCTGGGAT[C/T]TGGGGATCACACCAGTCTCACACCT
Phenotype: MIM: 602730 MIM: 604049
Polymorphism: C/T, Transition substitution
Allele Nomenclature
Literature Links: ACVR2B PubMed Links

Gene Details

Gene: ACVR2B
Gene Name: activin A receptor type 2B

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001106.3		Intron			NP_001097.2
XM_005265583.3		Intron			XP_005265640.1
XM_017007514.1		Intron			XP_016863003.1
XM_017007515.1		Intron			XP_016863004.1
XM_017007516.1		Intron			XP_016863005.1

Gene: ACVR2B-AS1
Gene Name: ACVR2B antisense RNA 1

There are no transcripts associated with this gene.

Gene: XYLB
Gene Name: xylulokinase

There are no transcripts associated with this gene.

View Full Product Details