Product Details
- SNP ID
-
rs411474
- Assay Type
- Functionally Tested
- NCBI dbSNP Submissions
-
NA
- Location
-
Chr.19:3136800 on Build GRCh38
- Set Membership
-
- Context Sequence [VIC/FAM]
- GAGAAGCCAAGTTCCTTGTCCAACG[C/T]GCGACCAGCGGCCAGGTGCCCAGGC
- Phenotype
-
MIM: 139314
- Polymorphism
- C/T, Transition Substitution
- Allele Nomenclature
-
- Literature Links
-
GNA15
PubMed Links
- Additional Information
-
For this assay, SNP(s) [rs113059695] are located under a primer sequence. To help evaluate the possible impact of a given SNP on your experiment, please refer to the 1000 Genomes and NCBI dbSNP databases. A higher minor allele frequency in your study population represents a higher risk to assay performance.
Gene Details
- Gene
- GNA15
- Gene Name
- G protein subunit alpha 15
| Transcript Accession |
SNP Location |
SNP Type |
Codon Change |
Amino Acid Change |
Protein ID |
| NM_002068.3 |
|
Intron |
|
|
NP_002059.3 |
- Gene
- LOC100996351
- Gene Name
- uncharacterized LOC100996351
There are no transcripts associated with this gene.
View Full Product Details