Product Details

SNP ID: rs313842
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.19:46721060 on Build GRCh38
Set Membership: HapMap
Context Sequence [VIC/FAM]: AGGCAACTCTCCCTGCCCCGCAGCA[C/T]TGACGCTGCAGCTGGGCAACAGGAA
Phenotype: MIM: 607074 MIM: 614767
Polymorphism: C/T, Transition substitution
Allele Nomenclature
Literature Links: LOC107987269 PubMed Links

Gene Details

Gene: LOC107987269
Gene Name: uncharacterized LOC107987269

There are no transcripts associated with this gene.

Gene: PRKD2
Gene Name: protein kinase D2

There are no transcripts associated with this gene.

Gene: STRN4
Gene Name: striatin 4

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001039877.1		Intron			NP_001034966.1
NM_013403.2		Intron			NP_037535.2
XM_006723171.2		Intron			XP_006723234.1
XM_006723172.2		Intron			XP_006723235.1
XM_006723174.2		Intron			XP_006723237.1
XM_011526878.1		Intron			XP_011525180.1
XM_011526879.1		Intron			XP_011525181.1
XM_017026716.1		Intron			XP_016882205.1
XM_017026717.1		Intron			XP_016882206.1
XM_017026718.1		Intron			XP_016882207.1
XM_017026719.1		Intron			XP_016882208.1

View Full Product Details