Product Details

SNP ID: rs504003
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.19:55654178 on Build GRCh38
Set Membership: HapMap
Context Sequence [VIC/FAM]: CCGCAGCGGTCGCGCGCACCCTTCA[C/T]CCCTCTTGCTGCTTTTGTCTGGCAC
Phenotype: MIM: 613478 MIM: 191318
Polymorphism: C/T, Transition substitution
Allele Nomenclature
Literature Links: CCDC106 PubMed Links

Gene Details

Gene: CCDC106
Gene Name: coiled-coil domain containing 106

There are no transcripts associated with this gene.

Gene: U2AF2
Gene Name: U2 small nuclear RNA auxiliary factor 2

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001012478.1	47	UTR 5			NP_001012496.1
NM_007279.2	47	UTR 5			NP_009210.1
XM_006722994.2	47	UTR 5			XP_006723057.1
XM_011526410.1	47	UTR 5			XP_011524712.1

Gene: ZNF581
Gene Name: zinc finger protein 581

There are no transcripts associated with this gene.

View Full Product Details