Product Details

SNP ID: hCV997364
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.11:119088672 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: CAGACGGACAGTGTGGTGGCAACAT[A/T]GAAAGCCTCGTACCCTGGCCTGCAG
Phenotype: MIM: 191350 MIM: 601772 MIM: 609806 MIM: 608549
Polymorphism: A/T, Transversion substitution
Allele Nomenclature
Literature Links: DPAGT1 PubMed Links

Gene Details

Gene: DPAGT1
Gene Name: dolichyl-phosphate N-acetylglucosaminephosphotransferase 1

There are no transcripts associated with this gene.

Gene: H2AFX
Gene Name: H2A histone family member X

There are no transcripts associated with this gene.

Gene: HMBS
Gene Name: hydroxymethylbilane synthase

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_000190.3	373	Nonsense Mutation	TAG,TTG	*42L	NP_000181.2
NM_001024382.1	373	Nonsense Mutation	TAG,TTG	*25L	NP_001019553.1
NM_001258208.1	373	Nonsense Mutation	TAG,TTG	*42L	NP_001245137.1
NM_001258209.1	373	Nonsense Mutation	TAG,TTG	*25L	NP_001245138.1

Gene: VPS11
Gene Name: VPS11, CORVET/HOPS core subunit

There are no transcripts associated with this gene.

View Full Product Details