Product Details

SNP ID: rs4187972
Assay Type: Pre Designed
NCBI dbSNP Submissions: NA
Location: Chr.16:55844692 on Build GRCm38
Set Membership
Context Sequence [VIC/FAM]: GGTCCACTGCAAGGAAGGGACCGAC[A/G]TTCTTGGGACTGCCCAAATTGAACT
Phenotype
Polymorphism: A/G, Transition substitution
Allele Nomenclature
Literature Links: Nfkbiz PubMed Links

Gene Details

Gene: Nfkbiz
Gene Name: nuclear factor of kappa light polypeptide gene enhancer in B cells inhibitor, zeta

There are no transcripts associated with this gene.

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001134457.1	1691	Silent Mutation			NP_001127929.1