Product Details

SNP ID: rs78320454
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.19:4294810 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: TGCGATCCGGTTTCTGTTCTGTGTG[A/G]GGTCATCTGCAGAGAAGAAATCTAT
Phenotype: MIM: 609828 MIM: 610481 MIM: 614715
Polymorphism: A/G, Transition substitution
Allele Nomenclature
Literature Links: FSD1 PubMed Links

Gene Details

Gene: FSD1
Gene Name: fibronectin type III and SPRY domain containing 1

There are no transcripts associated with this gene.

Gene: SHD
Gene Name: Src homology 2 domain containing transforming protein D

There are no transcripts associated with this gene.

Gene: TMIGD2
Gene Name: transmembrane and immunoglobulin domain containing 2

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001169126.1	467	Missense Mutation	CCC,CTC	P138L	NP_001162597.1
NM_001308232.1	467	Missense Mutation	CCC,CTC	P18L	NP_001295161.1
NM_144615.2	467	Missense Mutation	CCC,CTC	P138L	NP_653216.2
XM_017026284.1	467	Missense Mutation	CCC,CTC	P138L	XP_016881773.1

View Full Product Details