Product Details
- SNP ID
-
rs78922032
- Assay Type
- Functionally Tested
- NCBI dbSNP Submissions
-
NA
- Location
-
Chr.19:13777714 on Build GRCh38
- Set Membership
-
- Context Sequence [VIC/FAM]
- CTGGGGCAGAGGAGGCTGCCCTTCT[A/C]GAGGCTGGGACCAGAGGCTGTGGGC
- Phenotype
-
MIM: 615105
- Polymorphism
- A/C, Transversion Substitution
- Allele Nomenclature
-
- Literature Links
-
C19orf53
PubMed Links
- Additional Information
-
For this assay, SNP(s) [rs138544816] are located under a primer sequence. To help evaluate the possible impact of a given SNP on your experiment, please refer to the 1000 Genomes and NCBI dbSNP databases. A higher minor allele frequency in your study population represents a higher risk to assay performance.
Gene Details
- Gene
- C19orf53
- Gene Name
- chromosome 19 open reading frame 53
Transcript Accession |
SNP Location |
SNP Type |
Codon Change |
Amino Acid Change |
Protein ID |
NM_014047.2 |
|
Intron |
|
|
NP_054766.1 |
- Gene
- MRI1
- Gene Name
- methylthioribose-1-phosphate isomerase 1
There are no transcripts associated with this gene.
View Full Product Details