Product Details

SNP ID: rs113496065
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.22:19434808 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: AAGAAGCAAAGGAGCGCTTGAAAAG[A/G]AAGATCCGAAAACTGGAAAAGGCTA
Phenotype: MIM: 600237 MIM: 605089
Polymorphism: A/G, Transition substitution
Allele Nomenclature
Literature Links: C22orf39 PubMed Links

Gene Details

Gene: C22orf39
Gene Name: chromosome 22 open reading frame 39

There are no transcripts associated with this gene.

Gene: HIRA
Gene Name: histone cell cycle regulator

There are no transcripts associated with this gene.

Gene: MRPL40
Gene Name: mitochondrial ribosomal protein L40

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001318151.1	863	Silent Mutation	AGA,AGG	R26R	NP_001305080.1
NM_001318152.1	863	Silent Mutation	AGA,AGG	R26R	NP_001305081.1
NM_003776.3	863	Silent Mutation	AGA,AGG	R70R	NP_003767.2

View Full Product Details