Product Details

SNP ID

rs113411128

Assay Type

Functionally tested

NCBI dbSNP Submissions

NA

Location

Chr.4:53459413 on Build GRCh38

Set Membership

Context Sequence [VIC/FAM]

AAGAAGCGGGCAGTGAGCCTGCCCC[C/T]GAACAGGAGAGCACCGAAGCTACAC

Phenotype

MIM: 607686 MIM: 609732

Polymorphism

C/T, Transition substitution

Allele Nomenclature

Literature Links

FIP1L1 PubMed Links

Gene Details

Gene

FIP1L1

Gene Name

factor interacting with PAPOLA and CPSF1

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001134937.1	4185	Silent Mutation	CCC,CCT	P577P	NP_001128409.1
NM_001134938.1	4185	Silent Mutation	CCC,CCT	P509P	NP_001128410.1
NM_030917.3	4185	Silent Mutation	CCC,CCT	P583P	NP_112179.2
XM_005265769.4	4185	Silent Mutation	CCC,CCT	P592P	XP_005265826.1
XM_005265773.4	4185	Silent Mutation	CCC,CCT	P569P	XP_005265830.1
XM_005265774.4	4185	Silent Mutation	CCC,CCT	P560P	XP_005265831.1
XM_005265778.4	4185	Missense Mutation	CCG,CTG	P521L	XP_005265835.1
XM_005265779.4	4185	Missense Mutation	CCG,CTG	P512L	XP_005265836.1
XM_005265781.4	4185	Silent Mutation	CCC,CCT	P533P	XP_005265838.1
XM_005265782.4	4185	Silent Mutation	CCC,CCT	P524P	XP_005265839.1
XM_017008662.1	4185	Silent Mutation	CCC,CCT	P568P	XP_016864151.1
XM_017008663.1	4185	Silent Mutation	CCC,CCT	P556P	XP_016864152.1
XM_017008664.1	4185	Silent Mutation	CCC,CCT	P554P	XP_016864153.1
XM_017008665.1	4185	Silent Mutation	CCC,CCT	P547P	XP_016864154.1
XM_017008666.1	4185	Silent Mutation	CCC,CCT	P545P	XP_016864155.1
XM_017008667.1	4185	Silent Mutation	CCC,CCT	P541P	XP_016864156.1
XM_017008668.1	4185	Silent Mutation	CCC,CCT	P532P	XP_016864157.1
XM_017008669.1	4185	Silent Mutation	CCC,CCT	P518P	XP_016864158.1
XM_017008670.1	4185	Missense Mutation	CCG,CTG	P489L	XP_016864159.1
XM_017008671.1	4185	Missense Mutation	CCG,CTG	P462L	XP_016864160.1

Gene

LNX1

Gene Name

ligand of numb-protein X 1

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001126328.2	4185	Intron			NP_001119800.1
NM_032622.2	4185	Intron			NP_116011.2
XM_005265785.4	4185	UTR 3			XP_005265842.1
XM_017008776.1	4185	UTR 3			XP_016864265.1

View Full Product Details