Product Details

SNP ID

rs144723762

Assay Type

Functionally tested

NCBI dbSNP Submissions

NA

Location

Chr.10:68341230 on Build GRCh38

Set Membership

Context Sequence [VIC/FAM]

ATATTGATATTGGAGCTGATGGCAG[A/G]GCCACAGGAGAAGCAGATGTAGAGT

Phenotype

MIM: 602324 MIM: 612189 MIM: 610328

Polymorphism

A/G, Transition substitution

Allele Nomenclature

Literature Links

HNRNPH3 PubMed Links

Gene Details

Gene

HNRNPH3

Gene Name

heterogeneous nuclear ribonucleoprotein H3

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001322434.1	907	Silent Mutation	AGA,AGG	R232R	NP_001309363.1
NM_001322436.1	907	Silent Mutation	AGA,AGG	R232R	NP_001309365.1
NM_001322437.1	907	Silent Mutation	AGA,AGG	R232R	NP_001309366.1
NM_001322438.1	907	Silent Mutation	AGA,AGG	R217R	NP_001309367.1
NM_001322439.1	907	Silent Mutation	AGA,AGG	R217R	NP_001309368.1
NM_001322440.1	907	Silent Mutation	AGA,AGG	R217R	NP_001309369.1
NM_001322441.1	907	Silent Mutation	AGA,AGG	R217R	NP_001309370.1
NM_001322442.1	907	Silent Mutation	AGA,AGG	R226R	NP_001309371.1
NM_001322443.1	907	Silent Mutation	AGA,AGG	R226R	NP_001309372.1
NM_001322444.1	907	Silent Mutation	AGA,AGG	R124R	NP_001309373.1
NM_001322445.1	907	Silent Mutation	AGA,AGG	R101R	NP_001309374.1
NM_001322446.1	907	Silent Mutation	AGA,AGG	R101R	NP_001309375.1
NM_001322447.1	907	Silent Mutation	AGA,AGG	R101R	NP_001309376.1
NM_001322448.1	907	Silent Mutation	AGA,AGG	R101R	NP_001309377.1
NM_001322449.1	907	Silent Mutation	AGA,AGG	R101R	NP_001309378.1
NM_001322450.1	907	Silent Mutation	AGA,AGG	R95R	NP_001309379.1
NM_001322451.1	907	Silent Mutation	AGA,AGG	R63R	NP_001309380.1
NM_001322452.1	907	Silent Mutation	AGA,AGG	R63R	NP_001309381.1
NM_001322453.1	907	Silent Mutation	AGA,AGG	R63R	NP_001309382.1
NM_012207.2	907	Silent Mutation	AGA,AGG	R232R	NP_036339.1
NM_021644.3	907	Silent Mutation	AGA,AGG	R217R	NP_067676.2
XM_011539742.1	907	Silent Mutation	AGA,AGG	R124R	XP_011538044.1
XM_017016168.1	907	Silent Mutation	AGA,AGG	R232R	XP_016871657.1
XM_017016169.1	907	Silent Mutation	AGA,AGG	R101R	XP_016871658.1

Gene

PBLD

Gene Name

phenazine biosynthesis like protein domain containing

There are no transcripts associated with this gene.

Gene

RUFY2

Gene Name

RUN and FYVE domain containing 2

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001042417.1	907	Intron			NP_001035882.1
NM_001278225.1	907	Intron			NP_001265154.1
NM_017987.4	907	Intron			NP_060457.4
XM_005269953.4	907	Intron			XP_005270010.1
XM_005269955.4	907	Intron			XP_005270012.1
XM_005269956.4	907	Intron			XP_005270013.1
XM_005269957.4	907	Intron			XP_005270014.1
XM_006717911.3	907	Intron			XP_006717974.1
XM_011539942.2	907	Intron			XP_011538244.1

View Full Product Details