Product Details

SNP ID: rs139090970
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.11:66473371 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: GCCTGCCGCATCCTCTGTGACCGCC[A/G]GCCACCCTATACTGCCCGCATCTAT
Phenotype: MIM: 606818 MIM: 609827
Polymorphism: A/G, Transition substitution
Allele Nomenclature
Literature Links: DPP3 PubMed Links

Gene Details

Gene: DPP3
Gene Name: dipeptidyl peptidase 3

There are no transcripts associated with this gene.

Gene: LOC101928069
Gene Name: uncharacterized LOC101928069

There are no transcripts associated with this gene.

Gene: PELI3
Gene Name: pellino E3 ubiquitin protein ligase family member 3

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001098510.1	518	Missense Mutation	CAG,CGG	Q172R	NP_001091980.1
NM_001243135.1	518	Missense Mutation	CAG,CGG	Q133R	NP_001230064.1
NM_001243136.1	518	Missense Mutation	CAG,CGG	Q89R	NP_001230065.1
NM_145065.2	518	Missense Mutation	CAG,CGG	Q196R	NP_659502.2
XM_011544884.2	518	Missense Mutation	CAG,CGG	Q196R	XP_011543186.1
XM_017017465.1	518	Missense Mutation	CAG,CGG	Q47R	XP_016872954.1

View Full Product Details