Product Details
- SNP ID
-
rs144467940
- Assay Type
- Functionally Tested
- NCBI dbSNP Submissions
-
NA
- Location
-
Chr.11:55811924 on Build GRCh38
- Set Membership
-
- Context Sequence [VIC/FAM]
- GCTTCTTGCTGCTACTTCTGTGGGA[C/T]GGTGTGTTCTCTGATTCATTTGTGC
- Phenotype
-
- Polymorphism
- C/T, Transition Substitution
- Allele Nomenclature
-
- Literature Links
-
OR5D18
PubMed Links
- Additional Information
-
For this assay, SNP(s) [rs34948392] are located under a primer sequence. To help evaluate the possible impact of a given SNP on your experiment, please refer to the 1000 Genomes and NCBI dbSNP databases. A higher minor allele frequency in your study population represents a higher risk to assay performance.
Gene Details
- Gene
- OR5D18
- Gene Name
- olfactory receptor family 5 subfamily D member 18
There are no transcripts associated with this gene.
- Gene
- OR5L1
- Gene Name
- olfactory receptor family 5 subfamily L member 1 (gene/pseudogene)
Transcript Accession |
SNP Location |
SNP Type |
Codon Change |
Amino Acid Change |
Protein ID |
NM_001004738.1 |
458 |
Missense Mutation |
ACG,ATG |
T153M |
NP_001004738.1 |
View Full Product Details