Product Details

SNP ID: rs148055755
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.11:134249260 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: TGTGGTCTGGGTAAGCCTCTTTCAC[A/G]ATCTGAAACCAAAACAAAAGCTTTG
Phenotype: MIM: 604773 MIM: 613739 MIM: 610027
Polymorphism: A/G, Transition substitution
Allele Nomenclature
Literature Links: ACAD8 PubMed Links

Gene Details

Gene: ACAD8
Gene Name: acyl-CoA dehydrogenase family member 8

There are no transcripts associated with this gene.

Gene: THYN1
Gene Name: thymocyte nuclear protein 1

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001037304.1	489	Silent Mutation	ATC,ATT	I129I	NP_001032381.1
NM_001037305.1	489	Silent Mutation	ATC,ATT	I129I	NP_001032382.1
NM_014174.2	489	Silent Mutation	ATC,ATT	I129I	NP_054893.1
NM_199297.1	489	Silent Mutation	ATC,ATT	I129I	NP_954994.1
NM_199298.1	489	Silent Mutation	ATC,ATT	I129I	NP_954995.1
XM_005271527.3	489	Silent Mutation	ATC,ATT	I170I	XP_005271584.1
XM_005271528.3	489	Silent Mutation	ATC,ATT	I170I	XP_005271585.1

Gene: VPS26B
Gene Name: VPS26, retromer complex component B

There are no transcripts associated with this gene.

View Full Product Details