Product Details

SNP ID

rs148291205

Assay Type

Functionally tested

NCBI dbSNP Submissions

NA

Location

Chr.11:47274764 on Build GRCh38

Set Membership

Context Sequence [VIC/FAM]

CCCTCACTGACAAGGACACTGGAGT[C/T]ACGCGATATGGCATCTGTGTTAACT

Phenotype

MIM: 603584 MIM: 602423

Polymorphism

C/T, Transition substitution

Allele Nomenclature

Literature Links

LOC101928943 PubMed Links

Gene Details

Gene

LOC101928943

Gene Name

uncharacterized LOC101928943

There are no transcripts associated with this gene.

Gene

MADD

Gene Name

MAP kinase activating death domain

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001135943.1	479	Silent Mutation	GTC,GTT	V88V	NP_001129415.1
NM_001135944.1	479	Silent Mutation	GTC,GTT	V88V	NP_001129416.1
NM_003682.3	479	Silent Mutation	GTC,GTT	V88V	NP_003673.3
NM_130470.2	479	Silent Mutation	GTC,GTT	V88V	NP_569826.2
NM_130471.2	479	Silent Mutation	GTC,GTT	V88V	NP_569827.2
NM_130472.2	479	Silent Mutation	GTC,GTT	V88V	NP_569828.2
NM_130473.2	479	Silent Mutation	GTC,GTT	V88V	NP_569829.2
NM_130474.2	479	Silent Mutation	GTC,GTT	V88V	NP_569830.2
NM_130475.2	479	Silent Mutation	GTC,GTT	V88V	NP_569831.1
NM_130476.2	479	Silent Mutation	GTC,GTT	V88V	NP_569832.2
XM_005253189.2	479	Silent Mutation	GTC,GTT	V88V	XP_005253246.1
XM_005253196.2	479	Silent Mutation	GTC,GTT	V88V	XP_005253253.1
XM_005253199.2	479	Silent Mutation	GTC,GTT	V88V	XP_005253256.1
XM_005253200.2	479	Silent Mutation	GTC,GTT	V88V	XP_005253257.1
XM_005253201.2	479	Silent Mutation	GTC,GTT	V88V	XP_005253258.1
XM_005253203.2	479	Silent Mutation	GTC,GTT	V88V	XP_005253260.1
XM_005253204.2	479	Silent Mutation	GTC,GTT	V88V	XP_005253261.1
XM_005253205.1	479	Silent Mutation	GTC,GTT	V88V	XP_005253262.1
XM_017018478.1	479	Silent Mutation	GTC,GTT	V88V	XP_016873967.1
XM_017018479.1	479	Silent Mutation	GTC,GTT	V88V	XP_016873968.1
XM_017018480.1	479	Silent Mutation	GTC,GTT	V88V	XP_016873969.1
XM_017018481.1	479	Silent Mutation	GTC,GTT	V88V	XP_016873970.1
XM_017018482.1	479	Silent Mutation	GTC,GTT	V88V	XP_016873971.1
XM_017018483.1	479	Silent Mutation	GTC,GTT	V88V	XP_016873972.1
XM_017018484.1	479	Silent Mutation	GTC,GTT	V88V	XP_016873973.1
XM_017018485.1	479	Silent Mutation	GTC,GTT	V88V	XP_016873974.1
XM_017018486.1	479	Silent Mutation	GTC,GTT	V88V	XP_016873975.1
XM_017018487.1	479	Silent Mutation	GTC,GTT	V88V	XP_016873976.1
XM_017018488.1	479	Silent Mutation	GTC,GTT	V88V	XP_016873977.1
XM_017018489.1	479	Silent Mutation	GTC,GTT	V88V	XP_016873978.1
XM_017018490.1	479	Silent Mutation	GTC,GTT	V88V	XP_016873979.1
XM_017018491.1	479	Silent Mutation	GTC,GTT	V88V	XP_016873980.1
XM_017018492.1	479	Silent Mutation	GTC,GTT	V88V	XP_016873981.1
XM_017018493.1	479	Silent Mutation	GTC,GTT	V88V	XP_016873982.1
XM_017018494.1	479	Silent Mutation	GTC,GTT	V88V	XP_016873983.1
XM_017018495.1	479	Silent Mutation	GTC,GTT	V88V	XP_016873984.1
XM_017018496.1	479	Silent Mutation	GTC,GTT	V88V	XP_016873985.1
XM_017018497.1	479	Silent Mutation	GTC,GTT	V88V	XP_016873986.1
XM_017018498.1	479	Silent Mutation	GTC,GTT	V88V	XP_016873987.1
XM_017018499.1	479	Silent Mutation	GTC,GTT	V88V	XP_016873988.1
XM_017018500.1	479	Silent Mutation	GTC,GTT	V88V	XP_016873989.1
XM_017018501.1	479	Silent Mutation	GTC,GTT	V88V	XP_016873990.1
XM_017018502.1	479	Silent Mutation	GTC,GTT	V88V	XP_016873991.1
XM_017018503.1	479	Silent Mutation	GTC,GTT	V88V	XP_016873992.1
XM_017018504.1	479	Silent Mutation	GTC,GTT	V88V	XP_016873993.1
XM_017018505.1	479	Silent Mutation	GTC,GTT	V88V	XP_016873994.1
XM_017018506.1	479	Silent Mutation	GTC,GTT	V88V	XP_016873995.1
XM_017018507.1	479	Silent Mutation	GTC,GTT	V88V	XP_016873996.1
XM_017018508.1	479	Silent Mutation	GTC,GTT	V88V	XP_016873997.1
XM_017018509.1	479	Silent Mutation	GTC,GTT	V88V	XP_016873998.1
XM_017018510.1	479	Silent Mutation	GTC,GTT	V88V	XP_016873999.1

Gene

NR1H3

Gene Name

nuclear receptor subfamily 1 group H member 3

There are no transcripts associated with this gene.

View Full Product Details