Product Details

SNP ID: rs149587906
Assay Type: Functionally Tested
NCBI dbSNP Submissions: NA
Location: Chr.11:32097162 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: ACTGCAGGAAGATTGTTGATCGAAT[C/T]GACAATGATGGGGATGGCTTTGTCA
Phenotype: MIM: 602735
Polymorphism: C/T, Transition Substitution
Allele Nomenclature
Literature Links: RCN1 PubMed Links
Additional Information: For this assay, SNP(s) [rs564799768] are located under a primer sequence. To help evaluate the possible impact of a given SNP on your experiment, please refer to the 1000 Genomes and NCBI dbSNP databases. A higher minor allele frequency in your study population represents a higher risk to assay performance.

Gene Details

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_002901.2	539	Silent Mutation	ATC,ATT	I91I	NP_002892.1