Product Details

SNP ID: rs140151931
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.12:12361211 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: CAGTGTAACTTTATTTTCAGTGACT[A/C]CTTCACCAGCCAAGCATAGAGCCAA
Phenotype: MIM: 616598
Polymorphism: A/C, Transversion substitution
Allele Nomenclature
Literature Links: BORCS5 PubMed Links

Gene Details

Gene: BORCS5
Gene Name: BLOC-1 related complex subunit 5

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
XM_011520551.2	80	UTR 5			XP_011518853.1
XM_011520552.2	80	Intron			XP_011518854.1
XM_011520553.2	80	Missense Mutation	ACT,CCT	T22P	XP_011518855.1
XM_017018778.1	80	Missense Mutation	ACT,CCT	T22P	XP_016874267.1

Gene: LOH12CR2
Gene Name: loss of heterozygosity, 12, chromosomal region 2 (non-protein coding)

There are no transcripts associated with this gene.

View Full Product Details