Product Details

SNP ID: rs139828708
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.16:4695014 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: CCCAGAAGGACCGAGTCGGAGGCTT[A/C]CCCAACTTCCTGAGCAACGCCTTCG
Phenotype: MIM: 607559
Polymorphism: A/C, Transversion substitution
Allele Nomenclature
Literature Links: ANKS3 PubMed Links

Gene Details

Gene: ANKS3
Gene Name: ankyrin repeat and sterile alpha motif domain containing 3

There are no transcripts associated with this gene.

Gene: MGRN1
Gene Name: mahogunin ring finger 1

There are no transcripts associated with this gene.

Gene: NUDT16L1
Gene Name: nudix hydrolase 16 like 1

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001193452.1	575	Missense Mutation	ACC,CCC	T181P	NP_001180381.1
NM_032349.3	575	Missense Mutation	TTA,TTC	L157F	NP_115725.1
XM_005255633.4	575	UTR 3			XP_005255690.1

View Full Product Details