Product Details

SNP ID: rs146516670
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.16:4694970 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: CCTGTCTGCGCAGGTGCTGGGCCTC[A/G]TGCGGGTCCCGCTGTACACCCAGAA
Phenotype: MIM: 607559
Polymorphism: A/G, Transition substitution
Allele Nomenclature
Literature Links: ANKS3 PubMed Links

Gene Details

Gene: ANKS3
Gene Name: ankyrin repeat and sterile alpha motif domain containing 3

There are no transcripts associated with this gene.

Gene: MGRN1
Gene Name: mahogunin ring finger 1

There are no transcripts associated with this gene.

Gene: NUDT16L1
Gene Name: nudix hydrolase 16 like 1

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001193452.1	531	Missense Mutation	CAT,CGT	H166R	NP_001180381.1
NM_032349.3	531	Missense Mutation	ATG,GTG	M143V	NP_115725.1
XM_005255633.4	531	UTR 3			XP_005255690.1

View Full Product Details