Product Details

SNP ID: rs139064559
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.17:2324277 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: CTGGTTCTGGTACATATGGATCATA[A/T]GTCCATTTGGGGAAGACTCGTTTAT
Phenotype: MIM: 606477 MIM: 611214
Polymorphism: A/T, Transversion substitution
Allele Nomenclature
Literature Links: SNORD91A PubMed Links

Gene Details

Gene: SNORD91A
Gene Name: small nucleolar RNA, C/D box 91A

There are no transcripts associated with this gene.

Gene: SNORD91B
Gene Name: small nucleolar RNA, C/D box 91B

There are no transcripts associated with this gene.

Gene: SRR
Gene Name: serine racemase

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001304803.1	2716	UTR 3			NP_001291732.1
NM_021947.2	2716	UTR 3			NP_068766.1
XM_006721565.3	2716	UTR 3			XP_006721628.1
XM_006721566.3	2716	UTR 3			XP_006721629.1
XM_011523974.2	2716	UTR 3			XP_011522276.1

Gene: TSR1
Gene Name: TSR1, ribosome maturation factor

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_018128.4	2716	Silent Mutation	ACA,ACT	T778T	NP_060598.3

View Full Product Details