Product Details
- SNP ID
-
rs144568697
- Assay Type
- Functionally Tested
- NCBI dbSNP Submissions
-
NA
- Location
-
Chr.17:15651191 on Build GRCh38
- Set Membership
-
- Context Sequence [VIC/FAM]
- GCACTGCTGATCAGGGCAGCAGAAG[A/G]CAGACAGTGGGCTGTGGTGGGCAGG
- Phenotype
-
MIM: 609505
- Polymorphism
- A/G, Transition Substitution
- Allele Nomenclature
-
- Literature Links
-
TRIM16
PubMed Links
- Additional Information
-
For this assay, SNP(s) [rs4792642] are located under a probe sequence. To help evaluate the possible impact of a given SNP on your experiment, please refer to the 1000 Genomes and NCBI dbSNP databases. A higher minor allele frequency in your study population represents a higher risk to assay performance.
Gene Details
- Gene
- TRIM16
- Gene Name
- tripartite motif containing 16
Transcript Accession |
SNP Location |
SNP Type |
Codon Change |
Amino Acid Change |
Protein ID |
NM_006470.3 |
976 |
Missense Mutation |
|
|
NP_006461.3 |
View Full Product Details