Product Details

SNP ID: rs144236492
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.19:45693506 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: TCTCTGGAGCACTTATCTGCGCCCC[C/T]TGCTGGTTGTGCGAACCCCGGGCAG
Phenotype: MIM: 137241 MIM: 601061
Polymorphism: C/T, Transition substitution
Allele Nomenclature
Literature Links: GIPR PubMed Links

Gene Details

Gene: GIPR
Gene Name: gastric inhibitory polypeptide receptor

There are no transcripts associated with this gene.

Gene: QPCTL
Gene Name: glutaminyl-peptide cyclotransferase like

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001163377.1	601	Silent Mutation	CTG,TTG	L101L	NP_001156849.1
NM_017659.3	601	Silent Mutation	CTG,TTG	L101L	NP_060129.2
XM_011527048.2	601	Silent Mutation	CTG,TTG	L101L	XP_011525350.1
XM_017026900.1	601	Silent Mutation	CTG,TTG	L101L	XP_016882389.1

Gene: SNRPD2
Gene Name: small nuclear ribonucleoprotein D2 polypeptide

There are no transcripts associated with this gene.

View Full Product Details