Product Details

SNP ID: rs145784563
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.19:2252671 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: GGTCCTCCCGGACGGCCTCTCCGGT[A/G]GCCTCGCCGGGCTCCTCTTCGTCGT
Phenotype: MIM: 600957 MIM: 608743 MIM: 600796
Polymorphism: A/G, Transition substitution
Allele Nomenclature
Literature Links: AMH PubMed Links

Gene Details

Gene: AMH
Gene Name: anti-Mullerian hormone

There are no transcripts associated with this gene.

Gene: JSRP1
Gene Name: junctional sarcoplasmic reticulum protein 1

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_144616.3	1140	Silent Mutation	GCC,GCT	A218A	NP_653217.1
XM_017026285.1	1140	Silent Mutation	GCC,GCT	A271A	XP_016881774.1
XM_017026286.1	1140	Silent Mutation	GCC,GCT	A264A	XP_016881775.1
XM_017026287.1	1140	Silent Mutation	GCC,GCT	A225A	XP_016881776.1

Gene: MIR4321
Gene Name: microRNA 4321

There are no transcripts associated with this gene.

Gene: SF3A2
Gene Name: splicing factor 3a subunit 2

There are no transcripts associated with this gene.

View Full Product Details