Product Details

SNP ID: rs151120147
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.19:5684904 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: ATTATTGGGATGACAACTTCGACCC[A/T]GGTGAGCACCTGGGGTTGAGGGAGG
Phenotype: MIM: 616658 MIM: 605490
Polymorphism: A/T, Transversion substitution
Allele Nomenclature
Literature Links: C19orf70 PubMed Links

Gene Details

Gene: C19orf70
Gene Name: chromosome 19 open reading frame 70

There are no transcripts associated with this gene.

Gene: HSD11B1L
Gene Name: hydroxysteroid 11-beta dehydrogenase 1 like

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001267868.1	593	Silent Mutation	CCA,CCT	P71P	NP_001254797.1
NM_001267869.1	593	Intron			NP_001254798.1
NM_001267870.1	593	Silent Mutation	CCA,CCT	P24P	NP_001254799.1
NM_001267871.1	593	Silent Mutation	CCA,CCT	P24P	NP_001254800.1
NM_198533.2	593	Silent Mutation	CCA,CCT	P24P	NP_940935.1
NM_198704.2	593	Intron			NP_941993.1
NM_198705.2	593	Silent Mutation	CCA,CCT	P24P	NP_941994.1
NM_198706.2	593	Silent Mutation	CCA,CCT	P24P	NP_941995.1
NM_198707.2	593	Intron			NP_941996.1
NM_198708.2	593	UTR 5			NP_941997.1

Gene: LOC107985320
Gene Name: uncharacterized LOC107985320

There are no transcripts associated with this gene.

Gene: LONP1
Gene Name: lon peptidase 1, mitochondrial

There are no transcripts associated with this gene.

Gene: RPL36
Gene Name: ribosomal protein L36

There are no transcripts associated with this gene.

View Full Product Details