Product Details

SNP ID: rs145980514
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.20:45815435 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: CAGCTCAACAGTTTGTCTACTGTCC[A/G]GTCCCAGAGAAACTCAAGATTCTAG
Phenotype: MIM: 611388 MIM: 191039 MIM: 605574
Polymorphism: A/G, Transition substitution
Allele Nomenclature
Literature Links: DNTTIP1 PubMed Links

Gene Details

Gene: DNTTIP1
Gene Name: deoxynucleotidyltransferase, terminal, interacting protein 1

There are no transcripts associated with this gene.

Gene: TNNC2
Gene Name: troponin C2, fast skeletal type

There are no transcripts associated with this gene.

Gene: UBE2C
Gene Name: ubiquitin conjugating enzyme E2 C

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001281741.1		Intron			NP_001268670.1
NM_001281742.1		Intron			NP_001268671.1
NM_007019.3		Intron			NP_008950.1
NM_181799.2		Intron			NP_861515.1
NM_181800.2		Intron			NP_861516.1
NM_181801.3		Intron			NP_861517.1

View Full Product Details