Product Details

SNP ID: rs148802229
Assay Type: Functionally Tested
NCBI dbSNP Submissions: NA
Location: Chr.20:45221750 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: ATTGCCAAGCGGATCTTCCCAATTT[A/C]CACATGGACAAAAGGGCCAGCACTA
Phenotype: MIM: 182141
Polymorphism: A/C, Transversion Substitution
Allele Nomenclature
Literature Links: SEMG2 PubMed Links
Additional Information: For this assay, SNP(s) [rs2233896] are located under a probe sequence. To help evaluate the possible impact of a given SNP on your experiment, please refer to the 1000 Genomes and NCBI dbSNP databases. A higher minor allele frequency in your study population represents a higher risk to assay performance.

Gene Details

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_003008.2	139	Missense Mutation	ACA,CCA	T40P	NP_002999.1