Product Details

SNP ID: rs140006680
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.2:27129017 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: CCAAGCAGCCTGACAGCAGCCAAGA[C/T]CCTGATCCTACTACCCAGCCCATTG
Phenotype: MIM: 612195 MIM: 606137 MIM: 606395
Polymorphism: C/T, Transition substitution
Allele Nomenclature
Literature Links: ABHD1 PubMed Links

Gene Details

Gene: ABHD1
Gene Name: abhydrolase domain containing 1

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_032604.3	508	Silent Mutation	GAC,GAT	D116D	NP_115993.3
XM_011533135.2	508	Missense Mutation	GAC,GAT	D116D	XP_011531437.1
XM_011533136.2	508	Missense Mutation	GAC,GAT	D116D	XP_011531438.1
XM_011533137.2	508	Missense Mutation	GAC,GAT	D116D	XP_011531439.1
XM_011533138.2	508	Missense Mutation	GAC,GAT	D53D	XP_011531440.1
XM_017005113.1	508	Missense Mutation	GAC,GAT	D116D	XP_016860602.1

Gene: CGREF1
Gene Name: cell growth regulator with EF-hand domain 1

There are no transcripts associated with this gene.

Gene: PREB
Gene Name: prolactin regulatory element binding

There are no transcripts associated with this gene.

Gene: PRR30
Gene Name: proline rich 30

There are no transcripts associated with this gene.

View Full Product Details