Product Details

SNP ID: rs142911383
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.3:196947366 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: AGGCGGCAGAGCCATGGCCCACCAG[C/T]CACTTGGCAGGCTGGTTGTCTGGTG
Phenotype: MIM: 605133 MIM: 611671
Polymorphism: C/T, Transition substitution
Allele Nomenclature
Literature Links: NCBP2 PubMed Links

Gene Details

Gene: NCBP2
Gene Name: nuclear cap binding protein subunit 2

There are no transcripts associated with this gene.

Gene: NCBP2-AS2
Gene Name: NCBP2 antisense RNA 2 (head to head)

There are no transcripts associated with this gene.

Gene: PIGZ
Gene Name: phosphatidylinositol glycan anchor biosynthesis class Z

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_025163.3	1716	Missense Mutation	ACT,GCT	T511A	NP_079439.2
XM_011513190.1	1716	Missense Mutation	ACT,GCT	T550A	XP_011511492.1
XM_011513192.2	1716	Missense Mutation	ACT,GCT	T550A	XP_011511494.1
XM_017007240.1	1716	Missense Mutation	ACT,GCT	T576A	XP_016862729.1
XM_017007241.1	1716	Missense Mutation	ACT,GCT	T576A	XP_016862730.1
XM_017007242.1	1716	Missense Mutation	ACT,GCT	T361A	XP_016862731.1
XM_017007243.1	1716	Missense Mutation	ACT,GCT	T361A	XP_016862732.1

View Full Product Details