Product Details

SNP ID: rs144222810
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.5:81304832 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: CTGCAACATCATGGGAGGACATGAA[A/G]AAGGGATCCTTTGAGGGAACAAGCC
Phenotype: MIM: 614315
Polymorphism: A/G, Transition substitution
Allele Nomenclature
Literature Links: ACOT12 PubMed Links

Gene Details

Gene: ACOT12
Gene Name: acyl-CoA thioesterase 12

There are no transcripts associated with this gene.

Gene: CKMT2-AS1
Gene Name: CKMT2 antisense RNA 1

There are no transcripts associated with this gene.

Gene: ZCCHC9
Gene Name: zinc finger CCHC-type containing 9

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001131035.1	565	Silent Mutation	AAA,AAG	K25K	NP_001124507.1
NM_001131036.1	565	Silent Mutation	AAA,AAG	K25K	NP_001124508.1
NM_032280.2	565	Silent Mutation	AAA,AAG	K25K	NP_115656.1
XM_005248616.3	565	Intron			XP_005248673.1

View Full Product Details