Product Details

SNP ID: rs149454371
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.6:159779241 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: TTGTTTGTTGTCTCGAGGTTTACCA[C/T]TGCTCAAATCAAGACCAATCCTGCA
Phenotype: MIM: 100678 MIM: 186980
Polymorphism: C/T, Transition substitution
Allele Nomenclature
Literature Links: ACAT2 PubMed Links

Gene Details

Gene: ACAT2
Gene Name: acetyl-CoA acetyltransferase 2

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001303253.1	1710	Intron			NP_001290182.1
NM_005891.2	1710	Intron			NP_005882.2

Gene: SNORA20
Gene Name: small nucleolar RNA, H/ACA box 20

There are no transcripts associated with this gene.

Gene: SNORA29
Gene Name: small nucleolar RNA, H/ACA box 29

There are no transcripts associated with this gene.

Gene: TCP1
Gene Name: t-complex 1

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001008897.1	1710	Missense Mutation	AAT,AGT	N337S	NP_001008897.1
NM_030752.2	1710	Missense Mutation	AAT,AGT	N492S	NP_110379.2

View Full Product Details