Product Details

SNP ID: rs138169290
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.7:2256987 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: TGGTGCAGGCAGTACAGGGAGAAGT[A/T]GTTCCGCAGCTCCATCGTCTGAATC
Phenotype: MIM: 600312 MIM: 614905
Polymorphism: A/T, Transversion substitution
Allele Nomenclature
Literature Links: MIR6836 PubMed Links

Gene Details

Gene: MIR6836
Gene Name: microRNA 6836

There are no transcripts associated with this gene.

Gene: NUDT1
Gene Name: nudix hydrolase 1

There are no transcripts associated with this gene.

Gene: SNX8
Gene Name: sorting nexin 8

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_013321.3	1337	Missense Mutation	AAC,TAC	N391Y	NP_037453.1
XM_011515329.2	1337	Missense Mutation	AAC,TAC	N383Y	XP_011513631.1
XM_011515330.1	1337	Missense Mutation	AAC,TAC	N377Y	XP_011513632.1
XM_017012083.1	1337	Missense Mutation	AAC,TAC	N338Y	XP_016867572.1
XM_017012084.1	1337	Missense Mutation	AAC,TAC	N338Y	XP_016867573.1

View Full Product Details