Product Details

SNP ID: rs145301051
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.8:123249162 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: AATCCAAAGCTAATTAAACTGAACA[A/T]TTCTTCTACGAAGAAAGCGCATTTT
Phenotype: MIM: 604764
Polymorphism: A/T, Transversion substitution
Allele Nomenclature
Literature Links: C8orf76 PubMed Links

Gene Details

Gene: C8orf76
Gene Name: chromosome 8 open reading frame 76

There are no transcripts associated with this gene.

Gene: ZHX1
Gene Name: zinc fingers and homeoboxes 1

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001017926.2	4489	UTR 3			NP_001017926.1
NM_007222.4	4489	UTR 3			NP_009153.3

Gene: ZHX1-C8orf76
Gene Name: ZHX1-C8orf76 readthrough

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001204180.1	4489	Intron			NP_001191109.1

View Full Product Details