Product Details

SNP ID: rs138701847
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.9:108934503 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: GAGGTCGCCATGGCTACCGAGCCCG[A/C]AGCCGCGGAGCCGGTGGTGCCTTCG
Phenotype: MIM: 604785 MIM: 603722
Polymorphism: A/C, Transversion substitution
Allele Nomenclature
Literature Links: CTNNAL1 PubMed Links

Gene Details

Gene: CTNNAL1
Gene Name: catenin alpha like 1

There are no transcripts associated with this gene.

Gene: FAM206A
Gene Name: family with sequence similarity 206 member A

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_017832.3	107	Missense Mutation	GAA,GCA	E6A	NP_060302.1
XM_011518816.2	107	Missense Mutation	GAA,GCA	E6A	XP_011517118.1

Gene: IKBKAP
Gene Name: inhibitor of kappa light polypeptide gene enhancer in B-cells, kinase complex-associated protein

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001318360.1	107	Intron			NP_001305289.1
NM_003640.4	107	Intron			NP_003631.2
XM_011519136.1	107	Intron			XP_011517438.1
XM_011519137.1	107	Intron			XP_011517439.1
XM_017015238.1	107	Intron			XP_016870727.1

View Full Product Details