Product Details

SNP ID: rs146708538
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.9:35808266 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: TCCATGTCCTGCTGCAGACAGGGTG[A/T]TCATTCATTCCGCAAATGTTTACTG
Phenotype: MIM: 609997 MIM: 108961 MIM: 605731
Polymorphism: A/T, Transversion substitution
Allele Nomenclature
Literature Links: FAM221B PubMed Links

Gene Details

Gene: FAM221B
Gene Name: family with sequence similarity 221 member B

There are no transcripts associated with this gene.

Gene: HINT2
Gene Name: histidine triad nucleotide binding protein 2

There are no transcripts associated with this gene.

Gene: NPR2
Gene Name: natriuretic peptide receptor 2

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_003995.3	1528	Intron			NP_003986.2
XM_005251478.3	1528	Intron			XP_005251535.1
XM_005251479.4	1528	Intron			XP_005251536.1
XM_011517890.2	1528	Intron			XP_011516192.1
XM_011517891.2	1528	Intron			XP_011516193.1
XM_011517892.2	1528	Intron			XP_011516194.1
XM_011517893.2	1528	Intron			XP_011516195.1
XM_011517895.2	1528	Intron			XP_011516197.1
XM_017014745.1	1528	Intron			XP_016870234.1
XM_017014746.1	1528	Intron			XP_016870235.1
XM_017014747.1	1528	Intron			XP_016870236.1
XM_017014748.1	1528	Intron			XP_016870237.1
XM_017014749.1	1528	Intron			XP_016870238.1
XM_017014750.1	1528	Intron			XP_016870239.1

Gene: SPAG8
Gene Name: sperm associated antigen 8

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001039592.1	1528	Intron			NP_001034681.1
NM_172312.1	1528	Missense Mutation	GAA,GAT	E471D	NP_758516.1

View Full Product Details