Product Details

SNP ID: rs11171762
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.12:56161971 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: AAAGCCAGGCCATTATTAGCACTGC[A/C]TAAGCCTGTCCGTCACCTCAGCAGG
Phenotype: MIM: 609931 MIM: 609930 MIM: 601734
Polymorphism: A/C, Transversion substitution
Allele Nomenclature
Literature Links: LOC107987175 PubMed Links

Gene Details

Gene: LOC107987175
Gene Name: uncharacterized LOC107987175

There are no transcripts associated with this gene.

Gene: MYL6
Gene Name: myosin light chain 6

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_021019.4		Intron			NP_066299.2
NM_079423.3		Intron			NP_524147.2

Gene: MYL6B
Gene Name: myosin light chain 6B

There are no transcripts associated with this gene.

Gene: SMARCC2
Gene Name: SWI/SNF related, matrix associated, actin dependent regulator of chromatin subfamily c member 2

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
XM_005269101.1		Intron			XP_005269158.1
XM_005269102.1		Intron			XP_005269159.1
XM_005269103.1		Intron			XP_005269160.1
XM_005269104.1		Intron			XP_005269161.1
XM_011538693.2		Intron			XP_011536995.1
XM_017019884.1		Intron			XP_016875373.1
XM_017019885.1		Intron			XP_016875374.1
XM_017019886.1		Intron			XP_016875375.1
XM_017019887.1		Intron			XP_016875376.1

View Full Product Details