Product Details

SNP ID: rs182470865
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.2:27497602 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: TCCATTCTGACCACCATGGTACAGG[C/T]GGCTGGGAAAGTTCAGGAAGTGCTG
Phenotype: MIM: 611905 MIM: 600842 MIM: 607386
Polymorphism: C/T, Transition substitution
Allele Nomenclature
Literature Links: FNDC4 PubMed Links

Gene Details

Gene: FNDC4
Gene Name: fibronectin type III domain containing 4

There are no transcripts associated with this gene.

Gene: GCKR
Gene Name: glucokinase (hexokinase 4) regulator

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001486.3	323	Missense Mutation	GCG,GTG	A86V	NP_001477.2
XM_011532763.1	323	Missense Mutation	GCG,GTG	A86V	XP_011531065.1
XM_017003796.1	323	Intron			XP_016859285.1
XM_017003797.1	323	Intron			XP_016859286.1

Gene: IFT172
Gene Name: intraflagellar transport 172

There are no transcripts associated with this gene.

View Full Product Details