Product Details

SNP ID: rs183507938
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.X:13663471 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: GAACACTTTTCCTTCCCAGCTGGGT[A/G]CGGAATTCAAACCCAGATGAACAAA
Phenotype
Polymorphism: A/G, Transition substitution
Allele Nomenclature
Literature Links: LOC107985657 PubMed Links

Gene Details

Gene: LOC107985657
Gene Name: uncharacterized LOC107985657

There are no transcripts associated with this gene.

Gene: TCEANC
Gene Name: transcription elongation factor A N-terminal and central domain containing

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001297563.1	1295	Silent Mutation	GTA,GTG	V321V	NP_001284492.1
NM_001297564.1	1295	Silent Mutation	GTA,GTG	V321V	NP_001284493.1
NM_152634.3	1295	Silent Mutation	GTA,GTG	V351V	NP_689847.2
XM_017029316.1	1295	Silent Mutation	GTA,GTG	V351V	XP_016884805.1
XM_017029317.1	1295	Silent Mutation	GTA,GTG	V321V	XP_016884806.1
XM_017029318.1	1295	Silent Mutation	GTA,GTG	V321V	XP_016884807.1
XM_017029319.1	1295	Silent Mutation	GTA,GTG	V321V	XP_016884808.1

View Full Product Details