Product Details

SNP ID: rs183979417
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.4:185397193 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: TTGCTGGAGACAGGGGCCTCGGTCA[A/G]CGCACCCCCGGATCCCTGCAAGCAG
Phenotype: MIM: 611482
Polymorphism: A/G, Transition substitution
Allele Nomenclature
Literature Links: ANKRD37 PubMed Links

Gene Details

Gene: ANKRD37
Gene Name: ankyrin repeat domain 37

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_181726.3	154	Missense Mutation	AAC,AGC	N24S	NP_859077.1
XM_017008176.1	154	Missense Mutation	AAC,AGC	N24S	XP_016863665.1

Gene: C4orf47
Gene Name: chromosome 4 open reading frame 47

There are no transcripts associated with this gene.

Gene: LRP2BP
Gene Name: LRP2 binding protein

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_018409.3	154	Intron			NP_060879.2
XM_005263125.4	154	Intron			XP_005263182.1
XM_006714260.3	154	Intron			XP_006714323.1
XM_006714265.3	154	Intron			XP_006714328.1
XM_011532110.2	154	Intron			XP_011530412.1
XM_011532111.2	154	Intron			XP_011530413.1
XM_017008410.1	154	Intron			XP_016863899.1
XM_017008411.1	154	Intron			XP_016863900.1

Gene: UFSP2
Gene Name: UFM1 specific peptidase 2

There are no transcripts associated with this gene.

View Full Product Details