Product Details

SNP ID: rs186486022
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.19:15454697 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: AGGTTCTGGATGACCTTGGCAATCA[A/G]TGTGAGGGTGCGGGCTGGGCCGGGT
Phenotype: MIM: 616561
Polymorphism: A/G, Transition substitution
Allele Nomenclature
Literature Links: MIR1470 PubMed Links

Gene Details

Gene: MIR1470
Gene Name: microRNA 1470

There are no transcripts associated with this gene.

Gene: RASAL3
Gene Name: RAS protein activator like 3

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_022904.1	1995	Silent Mutation	CTG,TTG	L640L	NP_075055.1
XM_011528185.1	1995	Silent Mutation	CTG,TTG	L643L	XP_011526487.1
XM_011528186.1	1995	Silent Mutation	CTG,TTG	L637L	XP_011526488.1
XM_011528187.1	1995	Silent Mutation	CTG,TTG	L643L	XP_011526489.1

Gene: WIZ
Gene Name: widely interspaced zinc finger motifs

There are no transcripts associated with this gene.

View Full Product Details