Product Details

SNP ID: rs186750098
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.20:64073988 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: GCTGCGCGTCGTCGAACGTGTGTGC[A/G]GACGGCTCCTGCATCTTCTTGTTGA
Phenotype: MIM: 602548 MIM: 605071 MIM: 604784
Polymorphism: A/G, Transition substitution
Allele Nomenclature
Literature Links: LKAAEAR1 PubMed Links

Gene Details

Gene: LKAAEAR1
Gene Name: LKAAEAR motif containing 1

There are no transcripts associated with this gene.

Gene: MIR6813
Gene Name: microRNA 6813

There are no transcripts associated with this gene.

Gene: OPRL1
Gene Name: opioid related nociceptin receptor 1

There are no transcripts associated with this gene.

Gene: RGS19
Gene Name: regulator of G-protein signaling 19

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001039467.1	786	Silent Mutation	TCC,TCT	S173S	NP_001034556.1
NM_005873.2	786	Silent Mutation	TCC,TCT	S173S	NP_005864.1
XM_005260182.3	786	Silent Mutation	TCC,TCT	S151S	XP_005260239.1
XM_005260183.2	786	Silent Mutation	TCC,TCT	S151S	XP_005260240.1
XM_011528484.1	786	Silent Mutation	TCC,TCT	S202S	XP_011526786.1
XM_011528485.2	786	Silent Mutation	TCC,TCT	S173S	XP_011526787.1
XM_011528486.2	786	Silent Mutation	TCC,TCT	S173S	XP_011526788.1

Gene: TCEA2
Gene Name: transcription elongation factor A2

There are no transcripts associated with this gene.

View Full Product Details