Product Details

SNP ID: rs189717919
Assay Type: Functionally Tested
NCBI dbSNP Submissions: NA
Location: Chr.9:21350628 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: GTCCTTTGTGCTGAAGAGGTTGAAG[G/T]TCTGCTGAATCACCTCATGGAGGAC
Phenotype: MIM: 147566
Polymorphism: G/T, Transversion Substitution
Allele Nomenclature
Literature Links: IFNA6 PubMed Links
Additional Information: For this assay, SNP(s) [rs2988573] are located under a probe sequence. To help evaluate the possible impact of a given SNP on your experiment, please refer to the 1000 Genomes and NCBI dbSNP databases. A higher minor allele frequency in your study population represents a higher risk to assay performance.

Gene Details

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_021002.2	260	Missense Mutation			NP_066282.1