Product Details

SNP ID: rs190596211
Assay Type: Functionally tested
NCBI dbSNP Submissions: 12
Location: Chr.1:161230530 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: ACTAGTGAGGTAATGGATGTCATCA[A/G]TCTCAGGAATGCTATTACCCAGAGC
Phenotype: MIM: 107670 MIM: 603881
Polymorphism: A/G, Transition substitution
Allele Nomenclature
Literature Links: APOA2 PubMed Links

Gene Details

Gene: APOA2
Gene Name: apolipoprotein A2

There are no transcripts associated with this gene.

Gene: MIR5187
Gene Name: microRNA 5187

There are no transcripts associated with this gene.

Gene: NR1I3
Gene Name: nuclear receptor subfamily 1 group I member 3

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001077469.2	2695	Intron			NP_001070937.1
NM_001077470.2	2695	Intron			NP_001070938.1
NM_001077471.2	2695	Intron			NP_001070939.1
NM_001077472.2	2695	Intron			NP_001070940.1
NM_001077473.2	2695	Intron			NP_001070941.1
NM_001077474.2	2695	Intron			NP_001070942.1
NM_001077475.2	2695	Intron			NP_001070943.1
NM_001077476.2	2695	Intron			NP_001070944.1
NM_001077477.2	2695	Intron			NP_001070945.1
NM_001077478.2	2695	Intron			NP_001070946.1
NM_001077479.2	2695	Intron			NP_001070947.1
NM_001077480.2	2695	Intron			NP_001070948.1
NM_001077481.2	2695	Intron			NP_001070949.1
NM_001077482.2	2695	Intron			NP_001070950.1
NM_005122.4	2695	Intron			NP_005113.1
XM_005245693.4	2695	Intron			XP_005245750.1
XM_005245694.4	2695	Intron			XP_005245751.1
XM_005245697.4	2695	Intron			XP_005245754.1
XM_011510237.2	2695	Intron			XP_011508539.1

Gene: TOMM40L
Gene Name: translocase of outer mitochondrial membrane 40 like

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001286373.1	2695	UTR 3			NP_001273302.1
NM_001286374.1	2695	UTR 3			NP_001273303.1
NM_032174.5	2695	UTR 3			NP_115550.2
XM_006711572.2	2695	UTR 3			XP_006711635.1
XM_011510057.2	2695	UTR 3			XP_011508359.1
XM_017002481.1	2695	UTR 3			XP_016857970.1
XM_017002482.1	2695	UTR 3			XP_016857971.1

View Full Product Details