Product Details

SNP ID: rs191088176
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.X:13662970 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: CTAAGGAAGAGCATTTTGGGGATGG[C/T]GACCCTGAATCCACTGGCAAGAGAT
Phenotype
Polymorphism: C/T, Transition substitution
Allele Nomenclature
Literature Links: LOC107985657 PubMed Links

Gene Details

Gene: LOC107985657
Gene Name: uncharacterized LOC107985657

There are no transcripts associated with this gene.

Gene: TCEANC
Gene Name: transcription elongation factor A N-terminal and central domain containing

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001297563.1	794	Silent Mutation	GGC,GGT	G154G	NP_001284492.1
NM_001297564.1	794	Silent Mutation	GGC,GGT	G154G	NP_001284493.1
NM_152634.3	794	Silent Mutation	GGC,GGT	G184G	NP_689847.2
XM_017029316.1	794	Silent Mutation	GGC,GGT	G184G	XP_016884805.1
XM_017029317.1	794	Silent Mutation	GGC,GGT	G154G	XP_016884806.1
XM_017029318.1	794	Silent Mutation	GGC,GGT	G154G	XP_016884807.1
XM_017029319.1	794	Silent Mutation	GGC,GGT	G154G	XP_016884808.1

View Full Product Details