Product Details

SNP ID: rs202084070
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.12:122980409 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: TCGTATGGAGAGGGCAGGACCAGCC[A/G]GGGAGGAGGGCGGCGCGCGCGAGGG
Phenotype: MIM: 605453 MIM: 607668 MIM: 608920
Polymorphism: A/G, Transition substitution
Allele Nomenclature
Literature Links: ABCB9 PubMed Links

Gene Details

Gene: ABCB9
Gene Name: ATP binding cassette subfamily B member 9

There are no transcripts associated with this gene.

Gene: ARL6IP4
Gene Name: ADP ribosylation factor like GTPase 6 interacting protein 4

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001002251.2	350	Missense Mutation	AGG,GGG	R69G	NP_001002251.2
NM_001002252.2	350	Missense Mutation	AGG,GGG	R69G	NP_001002252.2
NM_001278378.1	350	Missense Mutation	AGG,GGG	R69G	NP_001265307.1
NM_001278379.1	350	Intron			NP_001265308.1
NM_001278380.1	350	UTR 5			NP_001265309.1
NM_016638.3	350	Missense Mutation	AGG,GGG	R69G	NP_057722.3
NM_018694.3	350	Missense Mutation	AGG,GGG	R69G	NP_061164.3

Gene: OGFOD2
Gene Name: 2-oxoglutarate and iron dependent oxygenase domain containing 2

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001304833.1	350	Intron			NP_001291762.1
NM_001304834.1	350	Intron			NP_001291763.1
NM_001304835.1	350	Intron			NP_001291764.1
NM_001304836.1	350	Intron			NP_001291765.1
NM_001304837.1	350	Intron			NP_001291766.1
NM_001304838.1	350	Intron			NP_001291767.1
NM_024623.2	350	Intron			NP_078899.1

Gene: PITPNM2
Gene Name: phosphatidylinositol transfer protein membrane associated 2

There are no transcripts associated with this gene.

View Full Product Details