Product Details

SNP ID: rs200600861
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.16:2974000 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: CCCCATACCCTGCACTTGAACCCAC[C/T]CTAGGCTGTCGTCATCCCAGTTGCT
Phenotype: MIM: 609899 MIM: 614578 MIM: 602474
Polymorphism: C/T, Transition substitution
Allele Nomenclature
Literature Links: KREMEN2 PubMed Links

Gene Details

Gene: KREMEN2
Gene Name: kringle containing transmembrane protein 2

There are no transcripts associated with this gene.

Gene: PAQR4
Gene Name: progestin and adipoQ receptor family member 4

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001284511.1	1606	Intron			NP_001271440.1
NM_001284512.1	1606	Intron			NP_001271441.1
NM_001284513.1	1606	Intron			NP_001271442.1
NM_001324118.1	1606	Intron			NP_001311047.1
NM_152341.4	1606	Intron			NP_689554.2

Gene: PKMYT1
Gene Name: protein kinase, membrane associated tyrosine/threonine 1

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001258450.1	1606	Missense Mutation	GAG,GGG	E368G	NP_001245379.1
NM_001258451.1	1606	Missense Mutation	GAG,GGG	E428G	NP_001245380.1
NM_004203.4	1606	Missense Mutation	GAG,GGG	E437G	NP_004194.3
NM_182687.2	1606	Missense Mutation	GAC,GGC	D437G	NP_872629.1
XM_011522734.2	1606	Missense Mutation	GAG,GGG	E437G	XP_011521036.1
XM_011522735.2	1606	Missense Mutation	GAG,GGG	E428G	XP_011521037.1
XM_011522736.2	1606	Missense Mutation	GAG,GGG	E428G	XP_011521038.1

View Full Product Details