Product Details

SNP ID: rs56184317
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.19:54813863 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: CCAGGACTCTGATGAACAAGACCCT[C/G]AGGAGGTGACATACGCACAGTTGGA
Phenotype: MIM: 604945 MIM: 604946
Polymorphism: C/G, Transversion substitution
Allele Nomenclature
Literature Links: KIR2DL4 PubMed Links

Gene Details

Gene: KIR2DL4
Gene Name: killer cell immunoglobulin like receptor, two Ig domains and long cytoplasmic tail 4

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001080770.1	925	Missense Mutation	CAG,GAG	Q261E	NP_001074239.1
NM_001080772.1	925	UTR 3			NP_001074241.1
NM_002255.5	925	Missense Mutation	CAG,GAG	Q296E	NP_002246.5

Gene: KIR3DL1
Gene Name: killer cell immunoglobulin like receptor, three Ig domains and long cytoplasmic tail 1

There are no transcripts associated with this gene.

Gene: LOC102724300
Gene Name: uncharacterized LOC102724300

There are no transcripts associated with this gene.

View Full Product Details