Product Details

SNP ID: rs201804689
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.19:6374888 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: TTCTTTGGGGAACGCCGGATTCCCC[A/G]GGGCCGGCGCATCTCCGTGATCTGC
Phenotype: MIM: 613305 MIM: 601119 MIM: 189968 MIM: 602921
Polymorphism: A/G, Transition substitution
Allele Nomenclature
Literature Links: ALKBH7 PubMed Links

Gene Details

Gene: ALKBH7
Gene Name: alkB homolog 7

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_032306.3	545	Missense Mutation	CAG,CGG	Q194R	NP_115682.1
XM_005259658.4	545	Missense Mutation	CAG,CGG	Q168R	XP_005259715.1
XM_017027355.1	545	Missense Mutation	AGG,GGG	R268G	XP_016882844.1

Gene: CLPP
Gene Name: caseinolytic mitochondrial matrix peptidase proteolytic subunit

There are no transcripts associated with this gene.

Gene: GTF2F1
Gene Name: general transcription factor IIF subunit 1

There are no transcripts associated with this gene.

Gene: PSPN
Gene Name: persephin

There are no transcripts associated with this gene.

View Full Product Details