Product Details

SNP ID
rs201929602
Assay Type
Functionally tested
NCBI dbSNP Submissions
NA
Location
Chr.4:88731387 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]
CCGAAGTTTCTTTCGAATCCTTTTC[C/T]TTTCTTCTCTCATTTCCTGGAGGTG
Phenotype
MIM: 613299 MIM: 613300
Polymorphism
C/T, Transition substitution
Allele Nomenclature
Literature Links
FAM13A PubMed Links

Gene Details

Gene
FAM13A
Gene Name
family with sequence similarity 13 member A
Transcript Accession SNP Location SNP Type Codon Change Amino Acid Change Protein ID
NM_001015045.2 4805 Missense Mutation AAG,AGG K636R NP_001015045.1
NM_001265578.1 4805 Missense Mutation AAG,AGG K622R NP_001252507.1
NM_001265579.1 4805 Missense Mutation AAG,AGG K608R NP_001252508.1
NM_001265580.1 4805 Missense Mutation AAG,AGG K608R NP_001252509.1
NM_014883.3 4805 Missense Mutation AAG,AGG K962R NP_055698.2
XM_005262681.2 4805 Missense Mutation AAG,AGG K948R XP_005262738.1
XM_005262682.2 4805 Missense Mutation AAG,AGG K942R XP_005262739.1
XM_005262683.2 4805 Missense Mutation AAG,AGG K934R XP_005262740.1
XM_005262684.3 4805 Missense Mutation AAG,AGG K753R XP_005262741.1
XM_006714057.3 4805 Missense Mutation AAG,AGG K773R XP_006714120.1
XM_011531516.1 4805 Missense Mutation AAG,AGG K962R XP_011529818.1
XM_011531517.1 4805 Missense Mutation AAG,AGG K934R XP_011529819.1
XM_011531518.1 4805 Missense Mutation AAG,AGG K776R XP_011529820.1
XM_011531519.2 4805 Missense Mutation AAG,AGG K776R XP_011529821.1
XM_017007624.1 4805 Missense Mutation AAG,AGG K920R XP_016863113.1
XM_017007625.1 4805 Missense Mutation AAG,AGG K907R XP_016863114.1
XM_017007626.1 4805 Missense Mutation AAG,AGG K785R XP_016863115.1
XM_017007627.1 4805 Missense Mutation AAG,AGG K753R XP_016863116.1
XM_017007628.1 4805 Missense Mutation AAG,AGG K711R XP_016863117.1
XM_017007629.1 4805 Missense Mutation AAG,AGG K690R XP_016863118.1
XM_017007630.1 4805 Missense Mutation AAG,AGG K690R XP_016863119.1
XM_017007631.1 4805 Missense Mutation AAG,AGG K676R XP_016863120.1
XM_017007632.1 4805 Missense Mutation AAG,AGG K676R XP_016863121.1
XM_017007633.1 4805 Missense Mutation AAG,AGG K641R XP_016863122.1
XM_017007634.1 4805 Missense Mutation AAG,AGG K594R XP_016863123.1
Gene
FAM13A-AS1
Gene Name
FAM13A antisense RNA 1
There are no transcripts associated with this gene.

View Full Product Details